Sanger sequencing: Common primers provided by the Nevada Genomics Center

All specific primers must be supplied by the client, but we have available free of charge a few common sequencing primers: M13(-21)F, M13(-46)R, T3, T7, and SP6.

Please note: there are several primers called: M13F, M13R, SP6, T7 and T3. Because of this you should be sure the primer sequence listed below is homologous to your vector’s priming site.

Common primers and their sequences
Name Sequence
M13(-21)F TGTAAAACGACGGCCAGT
M13(-46)R GAGCGGATAACAATTTCACACAG
T3 ATTAACCCTCACTAAAGGGA
T7 TAATACGACTCACTATAGGG
SP6 ACGATTTAGGTGACACTATAG
polyT mix TTTTTTTTTTTTTTTTTTTTTT(A/C/T/G)

Please check these primer sequences against your vector sequence before you have us use them on your samples!

Please see the guidelines on Sanger Sequencing: Optimal Amount of Template and Primer.