Sanger sequencing: Common primers provided by the Nevada Genomics Center

All specific primers must be supplied by the client, but we have available free of charge a few common sequencing primers: M13(-21)F, M13(-46)R, T3, T7, and SP6. If your template contains a poly A tail and you would like to sequence through it, please let us know before hand as we can use a "poly T mix" primer pool which has given good results with poly A regions.

For our Reno clients: please stop-by the Nevada Genomics Center and pick-up your free 100uL 2uM aliquot of primer for your sequencing.

For our clients outside Reno: at no extra cost we will add one of these common sequencing primers to your sequencing samples upon request.

Please Note: there are several primers called: M13F, M13R, SP6, T7 and T3. Because of this you should be sure the primer sequence listed below is homologous to your vector’s priming site.

Common primers and their sequences
Name Sequence
M13(-21)F TGTAAAACGACGGCCAGT
M13(-46)R GAGCGGATAACAATTTCACACAG
T3 ATTAACCCTCACTAAAGGGA
T7 TAATACGACTCACTATAGGG
SP6 ACGATTTAGGTGACACTATAG
polyT mix TTTTTTTTTTTTTTTTTTTTTT(A/C/T/G)

Please check these primer sequences against your vector sequence before you have us use them on your samples!

Please see the guidelines on Sanger Sequencing: Optimal Amount of Template and Primer.