Central Services Core

 

Please see the Sample Submission page for guidelines on preparation and submission of samples and the Price Lists page for current rates on all services.

 

DNA Purification

Bacterial plasmids are purified in a 96-well format using a Qiagen 3000 BioRobot. We use the Qiagen R.E.A.L. prep.  We can purify less than 96 samples if required.

 

DNA Quantitation

Double standed DNA is quantified using a fluorescent nucleic acid stain (PicoGreen®) and read on a Labsystems Fluoroskan Ascent fluorescence plate reader.   The commonly used technique for measuring nucleic acid concentration by the absorbance at 260 nm (A260) has the disadvantage of being affected by the presence of nucleotides, single-stranded nucleic acids and proteins - all contaminants commonly found in DNA preparations.  However, PicoGreen® measures only the double stranded DNA present. 

 

PCR cleanup

We use the Qiagen MinElute filter plate on the Qiagen BioRobot 3000 for PCR cleanup.  This is a size exclusion membrane so if your PCR reactions yield more than one product, they will all be purified.  In order to successfully sequence PCR products which have been purified with the filter plate, there must either be only one PCR product in the sample, or the sample must be sequenced with an internal primer which is specific to the product of interest.  We can process any number of samples.

 

Sequencing

The ABI BigDye Terminator Cycle Sequencing Ready Reaction Kit v3.1 is used in all sequencing reactions and the reactions are then run on the ABI3730 DNA Analyzer.  This yields 800bp, with 700-730 bases of Q>20 if the DNA is of good quality. Should regions of high GC content be encountered, we can change sequencing conditions for these samples.  A pGEM standard is run on each plate to validate the reactions. 

 

Average turnaround time is 2 to 4 working days after the samples have been received.

 

NGC checks the data from all plates.  If any problem appears to be an instrument or chemistry failure, the plate will be rerun at no charge.  If the client wishes samples to be rerun, NGC will rerun them.  If there is no improvement, then the client will be charged for the run, but if the sample gives a better result – an improvement of more than 100 in the Q>20 value – then NGC will not charge for the rerun.  If NGC sees an obvious problem with a sample, eg:  poor priming, insufficient template DNA, high salt concentration, G/C rich region, or double priming, then we will inform the researcher and suggest remedies.

 

We have available a few common sequencing primers [M13(-21)F, M13(-46)R, T3, T7, SP6]. Note: there are several primers called: M13F, M13R, SP6, T7 and T3 – be sure the primer sequence listed below is homologous to your vector if you wish to use it in a sequencing reaction.  All specific primers must be supplied by the client.  Please see the Submissions page for recommended quantities of template and primer.  If your template contains a poly A tail and you would like to sequence through it, please let us know before hand as we can use a "polyT mix" primer which has given good results with poly A regions.

 

Primers provided by NGC

Name	Sequence
M13(-21)F	TGTAAAACGACGGCCAGT
M13(-46)R	GAGCGGATAACAATTTCACACAG
T3	ATTAACCCTCACTAAAGGGA
T7	TAATACGACTCACTATAGGG
SP6	ACGATTTAGGTGACACTATAG
polyT mix	TTTTTTTTTTTTTTTTTTTTTT(A/C/T/G)

 

Please check these primer sequences against your vector sequence before you have us use them on your samples!

 

We use Edge BioSystems gel filtration plates to remove excess dye terminators after the reaction.  This clean-up step is essential because the excess dyes will produce large peaks that mask actual sequence during analysis.

 

It is essential to the success of the sequencing reaction that the DNA be purified using a method that gives good quality DNA. For plasmids we are using Qiagen R.E.A.L. kits.  For PCR products spin column cleanup can be used if there is only one PCR product.  When the PCR reaction yields more than one product and the primer used for sequencing is the same as one of those used to generate the PCR product, then that primer will sequence every PCR product present and the result will be unreadable sequence.  In this case the PCR products should be separated on an agarose gel and the band of interest excised from the gel. Glass bead cleanup kits e.g. GeneClean can be used to purify the DNA from the agarose (as long as you wash ALL the salt out).  A second option for multiple PCR products is to sequence with an internal primer which will only see the band of interest.  Be aware that spin column cleanup of PCR products does not remove all of the PCR primers and these will carry over into the sequencing reaction.  If the PCR yield is high and the PCR product size is greater than 300 base pairs, the effect of these PCR primers in the sequencing reaction is negligible.  However, for small PCR products, with low yield, the PCR primers can generate significant sequence, and agarose gel purification is recommended.

 

Please resuspend the DNA in water, not TE because EDTA's ability to bind Mg++ can hinder the sequencing reaction.

 

Sequencing Analysis

Samples are analyzed in 96-well format on an ABI Prism 3730 DNA analyzer. The data is transferred to our dnaTools server for DNA sequence sample management. Data can be uploaded, accessed, or downloaded from the dnaTools server once a user account has been established. The server can calculate the Phred Q>20 values for all sequences and these can be downloaded and viewed.  The sequence information or the chromatograms can be downloaded.  The chromatograms can also be viewed or printed.  Downloads can be either individually or by order number.

  

In order to view the chromats on your computer you will need to download the freeware Java viewer:  http://java.com/en/ .  Alternatively, to view these files on your computer or to download them and then open the .ab1 files with another program you will need to download the freeware version of FinchTV from the Geospiza website http://www.geospiza.com/finchtv/index.htm.  FinchTV is a viewer for the ab1 sequencing files.

 

Downloading Your Sequencing Data

dnaTools server:  Please read our guide on the dnaTools server for instructions:

Sequencing Sample dnaTools Instructions

Files will be downloaded as compressed (zipped) files.  The chromatograms will have the .ab1 file extension on them.  Other options will contain different file extensions depending on the data downloaded.  For example: Text = .seq   Phred quality scores = .qual   These files can be viewed in Microsoft Word or Excel. 

 

Finch server:  As of November 6, 2006, the NGC will no longer be using the Finch server for data retrieval.  We will keep the server up and running for you to access previous data. 

 

For whole folders (Finch):  With the folder open click on the download option in the right top of the page, and choose 'export chromatograms' (uncompressed is fine).  This will give you a .tar file which can be extracted with a file compression program (like Winzip or Suntar).  Those file will then open in the FinchTV viewer. 

 

For individual files (Finch): Click on the file name on Finch and in the right top of the page you will find the download option for the file.  Download the chromatogram.  Before you save the file, add the extension:  .ab1  to the file.  The individual files do not receive the .ab1 extension and won't open by double clicking them unless you add it.

 

Fragment Analysis

Please read our guide on the dnaTools server for instuctions:

Fragment Analysis dnaTools Instructions

Fragment analysis can be performed using microsatellite or RFLP techniques.  Samples are run in 96-well format, 48 wells at a time, on the ABI Prism 3730 DNA Analyzer.  The filter set used is G5, which detects the fluorescent dyes 6-FAM, VIC, NED and PET.  The 500MW size standards are labeled with LIZ.  Data files are uploaded to the dnaTools server where they are distributed to user accounts for download by the user. You can view the data on the dnaTools server.  In order to view the raw data on your computer you will need to download the freeware Java viewer:  http://java.com/en/ .For further analysis, you can download the freeware Peak Scanner™ Software v1.0 from Applied Biosystems: http://marketing.appliedbiosystems.com/mk/get/PS1_login.  Alternatively, you can purchase a copy of the Applied Biosystems GeneMapper software.

 

Microarrays

Because microarrays are such an individualized procedure, please call us to discuss your specific needs.  We process Affymetrix chips.

 

Real Time Quantitative PCR

The ABI Prism 7000 Sequence Detection System is used for real time quatitation of DNA.  Currently, the NGC does not create templates by reverse transcription or set up reactions.  The instrument is available to run plates that have already been set up.  Your data will be emailed to you in the form of an Applied Biosystems .sds file.

 

Billing

Invoices are sent each month, for samples which have been run during that month.  We accept credit cards or purchase orders.  We will need a mailing address for the invoices, and if a PO is to be referenced on the invoice we will need the PO number when the samples are submitted.